Friend Leukaemia Integration 1 is Associated with Conception Rate in Holsteins

Mayumi Sugimoto1*, Toshimi Baba2, Yusaku Gotoh2, Takayoshi Kawahara2 and Yoshikazu Sugimoto3

1National Livestock Breeding Center, Nishigo, Fukushima, Japan

2Holstein Cattle Association of Japan, Hokkaido Branch, Sapporo, Hokkaido, Japan

3Shirakawa Institute of Animal Genetics, Nishigo, Fukushima, Japan

*Corresponding Author:
Mayumi Sugimoto
National Livestock Breeding Center
Nishigo, Fukushima, Japan
E-mail: [email protected]

Received date: March 04, 2016; Accepted date: April 11, 2016; Published date: April 15, 2016

Citation: Sugimoto M, et al. Friend Leukaemia Integration 1 is Associated with Conception Rate in Holsteins. Reproductiv Immunol Open Acc. 2016, 1:7. doi: 10.4172/2476-1974.100007

Copyright: © 2016 Sugimoto M, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

 
Visit for more related articles at Reproductive Immunology: Open Access

Abstract

Background: Conception rate is an economically important trait in the dairy industry; however, it has decreased dramatically over recent decades. Conception is a complex process including follicle development, ovulation, fertilization, implantation, and placental differentiation and numerous factors contribute to this event. The present study aims to explore the genetics of conception rate in Holsteins using a genome-wide association study (GWAS). Methods and Findings: Our GWAS for conception rate based on 2,559 Holstein sires found that the conception rate is influenced by a single nucleotide polymorphism GA-266del in the 5’ untranslated region of friend leukaemia integration 1 (FLI1). Cows with higher conception rates carried the GA polymorphism in the FLI1 5’ untranslated region. Luciferase assays and quantitative analysis of allele ratios revealed that FLI1 transcripts with the GA polymorphism were expressed at higher levels than those carrying the deletion polymorphism. FLI1 is a member of the ETS gene family of transcription factors and disruption of FLI1 increased natural killer cell population. High levels of natural killer cells were correlated with spontaneous abortion in human. Cows with the deletion polymorphism released higher levels of perforin, a product of natural killer cells, than did cows with the GA polymorphism. Moreover, cows with the deletion polymorphism have lower successful rate for pregnancy after embryo transfer than cows with the GA polymorphism. Conclusions: These observations suggest that cows carrying the deletion polymorphism in FLI1 might have lower conception rates because of the enhanced perforin production. Thus, this study provides novel insights into the role of FLI1 during reproduction process.

Keywords

Conception; GWAS; FLI1; NK cells; Perforin

Introduction

Dairy production depends on the frequency at which cows conceive; thus, conception rate (CR) is essential for this industry. Studying the genetics of CR using a genome-wide association study (GWAS) may be helpful for understanding the underlying biological mechanisms and beneficial for the industry. Here we report a new gene, friend leukaemia integration 1 (FLI1), which is associated with CR in the Holstein cattle population.

FLI1 is a proto-oncogene and belongs to the ETS gene family of transcription factors [1]. The targeted disruption of Fli1 in mice increased numbers of natural killer (NK) cell [2]. High levels of NK cells in the peripheral blood of patients were correlated with spontaneous abortion in human [3]. Activation of NK cells by polynucleotides can cause abortion in pregnant mice [4]. Moreover, the decidual Va14 NKT cells, a subset of NK cells, were involved in abortion through perforindependent pathway [5]. Perforin, a pore-forming protein, acts as a host defence molecule protecting both the mother and the fetus from a wide spectrum of pathogens and also acts as an effector molecule causing the apoptosis of trophoblast cells leading to various pregnancy disorders [6]. Therefore, FLI1 might be correlated with CR through perforin-dependent pathway in ruminants.

In this work, we performed a GWAS on 2,559 Holstein sires and identified a single nucleotide polymorphism (SNP) in the 5’ untranslated region (UTR) of FLI1 that influences the CR of cows. Cows with the deletion polymorphism were less fertile than cows with the GA polymorphism, and this SNP decreased the expression of FLI1. We demonstrated that cows with the deletion polymorphism release more perforin compared with cows with the GA polymorphism. In addition, cows with the deletion polymorphism have lower success rate for pregnancy after embryo transfer than cows with the GA polymorphism. Thus, we propose that FLI1 keeps a low level of perforin that maintains pregnancy.

Methods

Samples

We collected DNA from 2,559 Holstein sires and evaluated the estimated breeding values (EBVs) for the CRs [7,8]. The EBVs for the CRs of the sires were evaluated based on their daughters’ CRs. The EBVs for CRs of daughters were evaluated by threshold linear models using insemination event data after first calving. The threshold-linear repeatability animal model to estimate EBV of CR can be written as:

l=Xβ+Whh+Wss+Zaa+Zpp+e

where l is a vector of unobserved liabilities converted from insemination events data, which collected as a longitudinal binary response of either a success or a failure. ; β is the fixed vector of systematic effects (age at insemination, month of insemination, days from calving to insemination, regression coefficients on inbreeding); his the random vector of herdyear- season at insemination; sis the random vector for interaction of service sires and years ; ais the random vector of additive breeding values; pis the random vector of permanent environmental effects; eis the random vector of residual terms; and X, Wh, Ws, Za, and Zp are known incidence matrices with the appropriate dimensions. The EBV for the CRs of the population was distributed as shown in Figure 1A.

reproductive-immunology-Conception-rate

Figure 1a: Conception rate (CR) is associated with SNP ARSBFGL- NGS-12309. A. The distribution of the EBV for CRs among 2,559 Holsteins.

Whole-genome scan

We genotyped 2,559 samples using a Bovine SNP 50 v1 DNA Analysis Kit ( Illumina, San Diego, CA, USA) for a total of 54,035 SNPs and conducted an association analysis using EMMAX software [9].

Identification of novel SNPs

Based on the Nov. 2009 Bos taurus draft assembly [10] (UMD_3.1), each of the exons, 2 kb of the 5’UTRs and 2 kb of the 3’UTRs of the genes located in the associated regions were amplified by polymerase chain reaction (PCR) and sequenced. The genome-wide regions that included significant SNPs as well as their neighbouring SNPs with r2 values greater than 0.2 were defined as the associated regions. The r2 values were calculated by a linkage disequilibrium analysis using PLINK software [11]. The primers for each gene and the samples used to compare the sequences are shown in Tables 1 and 2, respectively.

Gene Position Primer Sequence
ETS1 5'UTR-1 Forward GTGGTTAGCAGTGTTTAGGCT
    Reverse ACACACCTGCTTACCTCATCT
  5'UTR-2 Forward TTCTCTTCCTGGCTCCTTCC
    Reverse TGTCACCACTGGCCAAAATT
  5'UTR-3 Forward CAGAGCTGTGCATCATGTTTT
    Reverse TCCACGCATTCTTGAGGACT
  5'UTR-4 Forward AGCAGCCCAAGTCCAGTATT
    Reverse GGGGAATCGGACCTTCTTCT
  exon 1 Forward AGAGATCCTGAGGGTGGGG
    Reverse GGGGAGAAGTGGAGGGGA
  exon 2 Forward GCAGAACGATCACCACCATC
    Reverse GGTCCATCCTCTCTCCTTCC
  exon 3 Forward TTTCGTGTAGTCTCCGAGGC
    Reverse CACCCTGTCCTCATGCATTT
  exon 4 Forward TGAGATCACTGTGGTCCTCG
    Reverse GGAAGAGAGAAGAGGAGCCA
  exon 5 Forward TCTCCTCTCTCCAATCGCAC
    Reverse TGGCTAAGAGTGAGGGAGGA
  exon 6 Forward GTGTCTCTTCCCATCCCTCC
    Reverse CAGAAGTGTCCAGGGAGCC
  exon 7 Forward TTCACCATGGCTTGTGTCTC
    Reverse ACACCATCAAGCCCCATACA
  exon 8 Forward CACCAATGAGTGCAGGCATA
    Reverse TCAGAATCCTCAGTCGGCAA
  3'UTR-1 Forward GATGGACTTCAGTGGGGAGG
    Reverse ATAAATGTGGGGTGCTGGGA
  3'UTR-2 Forward GGAAAGAGGGAGTGAAGGGA
    Reverse TTGACAATGGCCTCGGTTTG
  3'UTR-3 Forward AAGGAAGGAAGCTTGAAGGC
    Reverse CTCCCTGAGCAGCTCCTAAA
  3'UTR-4 Forward GCCCAGCTGTGTATTGTGAT
    Reverse TCTTCCTGGGATGGTCTCTG
FLI1 5'UTR-1 Forward GAGGAAAGGGTTAAGCCTGATT
    Reverse CTTCTTTCTCCCCGACTTCC
  5'UTR-2 Forward AAAGTCCAAAGCGTGGTCTG
    Reverse TGCATCCAATGGGAAGTTTT
  5'UTR-3 Forward GAGCTCTCCAGTAGCCCAGA
    Reverse TTGTTCCCGGGAGATAAGG
  5'UTR-4 Forward TGCAGACTTTGGGAATCAGG
    Reverse GCGGAAGGAAGGGAGAGT
  exon 1 Forward CTTTTTCGCTCCGCTACAAC
    Reverse GCGGAAGGAAGGGAGAGT
  exon 2 Forward GGGCTCTGTGTCCTTCTCTG
    Reverse CGTCTGCCACAGACACACTT
  exon 3 Forward CCTTCCCCTGAGCTTTGTCT
    Reverse AGTGAAAGGGTTCCCGAAGT
  exon 4 Forward TTGCTAACAGCCTGTCTCTCC
    Reverse TAGGGACCGGGCACTTAC
  exon 5 Forward GTTTTTGCTTCGCCTTTCAG
    Reverse CCCAGTCTTCCCATCACAGT
  exon 6 Forward CTGCCACTCCATGAGCTGTA
    Reverse CGCTTATGACCCTGTTCTCC
  exon 7 Forward GGGAGTGAGTGAATGGGAAA
    Reverse AGGGTTCGAACATCATGGAC
  exon 8 Forward TCAGGCTTTCCTATGATCTCAA
    Reverse ACACAACCTCTCAGGCCAAA
  exon 9 Forward TCTCAGGTGGAGCCTGTTTT
    Reverse CCACCGATGAGGAAGCAT
  3'UTR-1 Forward CATCTACCCCAACCCCAAC
    Reverse GTTCCAGTTGCCCTCCACT
  3'UTR-2 Forward GGCAGGAAGCTTATCATCTTATC
    Reverse AACGTACAAGCAGCCCAAAT
  3'UTR-3 Forward GAGTTGACCTCGGTCACAGAT
    Reverse CTGGGAAAACCCTTGGACCT
  3'UTR-4 Forward TTGTGCCTTCTTCTCTCAGAAC
    Reverse CTACACCATCAGCCGGTTTC
KCNJ1 5'UTR-1 Forward AGGCTGGTCTGAGGGACAAT
    Reverse CCTTTCTCCCTGGCTTTACC
  5'UTR-2 Forward AAAGAAAAGCCTTCCATGAGC
    Reverse CTCCAGTCAGTGCAGAACCA
  5'UTR-3 Forward TGCAAATGAATGAGGCACTT
    Reverse TGGCATTGAGTGACTGTTCC
  5'UTR-4 Forward TGTGTGAGCCAGAGATGACC
    Reverse TCAGACCAGCTGCCAACTC
  exon 1 Forward TGTATCCTGCCCACTTACCC
    Reverse TATGGCATTTCTCCGCTTAC
  exon 2 Forward CTTCTCTTAGTGACTTTCTGTTCTGA
    Reverse CCCCTGTCCTGTGATGAATG
  exon 3 Forward TCTGTTTTGTCTTTCTCTGATGTGT
    Reverse ACTCGTGTGGAAAACTCAGC
  3'UTR-1 Forward TGAAACAGACGACACCAAAA
    Reverse GAGCCAATGTTCAAATAAAAGTGA
  3'UTR-2 Forward ATGGACAGGCCAAATGAGAT
    Reverse TGCCTTCTTGGAAGATCAGC
  3'UTR-3 Forward CGCTGGCTTCAAATCTGTTA
    Reverse GGACGTCACAACGTCAGAGA
  3'UTR-4 Forward GTATTCTGGAGCGGACGGTA
    Reverse TCATAGCAATGGGTCAGCAG
ARHGAP32 5'UTR-1 Forward CTGTGCCTCTCATTGTGCTG
    Reverse TGAGTTGTATGAGCTACTTGTGT
  5'UTR-2 Forward ACAGAATGGGAGGAAATATTTGC
    Reverse TCATCTCTAGCTCCATCCATGT
  5'UTR-3 Forward ATCCTGTAGTGCCACTCCTG
    Reverse GACTGTGAACCAATCCAACATAA
  5'UTR-4 Forward ACTTCAACTTAAGGGGAACGTG
    Reverse CGAATCCAACCAGAACACG
  exon 1 Forward GAACAACCTGGACACTGCTG
    Reverse AGATGAGGGAGGTGGAGAGA
  exon 2 Forward TGGATTGTAGTCATTGGAAGGC
    Reverse TGCTTCCCCTGTTCCTTTTC
  exon 3 Forward TCTTTTGGTATGGAGTTAGGACC
    Reverse TGTATGGACAGTAAGAGCTCATT
  exon 4 Forward TGTTCCAGGATCTTGTCTCTCA
    Reverse ACGCCTCGCTTCAGTATGTA
  exon 5 Forward ACCGTGACTTTCTTTCCCTCT
    Reverse TGCAGAAATGCCAATGTGACT
  exon 6 Forward TCGCTAGAGGGTTTTGGAGT
    Reverse CCCATGAATCTTCCTGAGTGC
  exon 7 Forward TCTGTGAAGAACCTCTGTGACT
    Reverse CACATGGGATTTCTTTCGTAGGT
  exon 8 Forward CTTGCAAGTCCCGTGTCTTT
    Reverse GCTAGAAAGGCAGCACAGAC
  exon 9 Forward GACCAGTCTTTGTGCTGCTT
    Reverse CACACCGAATTCTTTGTTGCG
  exon 10 Forward GCTCACACACTGGTCTGTTC
    Reverse TGACAACGAACACAACAGCT
  exon 11 Forward TGCACTTCATTTCCTCTTGCT
    Reverse GGAGATCAACAGGGAGAGGT
  exon 12 Forward TTAATCTCCACCCCTTACAGC
    Reverse GAGGCCAAGGTTTTCTGATACT
  exon 13-14 Forward CTCACTGAGCTGGAGGTTAAT
    Reverse TGGCATTTTACAGAGCGTGG
  exon 15-16 Forward ACTCCCTGATGTTTCTTTGTGT
    Reverse TTAAAGATACGTTCCCAGGGG
  exon 17 Forward AGTTTGAGTCTTGTCGTTGCT
    Reverse CCACAGTCGAATGAACAGGT
  exon 18 Forward TTGGATGCCTTAATGCGGAC
    Reverse AAGGGAAGGCGTGAACACT
  exon 19 Forward ACGTTGTTTGGTTTTGATTCTGC
    Reverse CGTAGTGACTGAACAACAACAAC
  exon 20 Forward AGCTGACTCATAGGGCACTG
    Reverse AAGCAAGAATGGAGGAAAACAAA
  exon 21-1 Forward ACACAAGCTACCTTTTCACTTTC
    Reverse GGCACACTGGTCTTCACAGA
  exon 21-2 Forward CAGAGTCACTTCCGTTCCCT
    Reverse GGCACACACTGATGGAGAGT
  exon 22-1 Forward ATTCCGCCTGCAGTCCAT
    Reverse GGTCTGGAAGCCCTTTGG
  exon 22-2 Forward GGGCAGAGTATGTGTCCTCA
    Reverse GGAGTCCAGTTTTCCCAGGA
  exon 22-3 Forward GAGAAATACCGCCTGCAGTC
    Reverse CCTCCAGGTTATCGTACTGC
  exon 22-4 Forward GGGTCACCTGTTTTCTTTGTCA
    Reverse ACTGAAGTGTGTGGAGCAAC
  3'UTR-1 Forward GACCCATTAGATCCAGGCTGA
    Reverse GCTGGTGTGGATGGCAATTA
  3'UTR-2 Forward GGAATTACCGTGTTGTGTCTTC
    Reverse ACACCTAACAGAGTATTTCCACA
  3'UTR-3 Forward TCATGTGATTGCATTTTAAGGGT
    Reverse ACGTTTCACACTTTCACCAGG
  3'UTR-4 Forward GGTCACACACACTGTTTACTCC
    Reverse TACTGAAAGGAGGCGGCATC
JAM3 5'UTR-1 Forward GCATAGACTCCACAGCCCTA
    Reverse CAGCCTCTGTCCCATAAACA
  5'UTR-2 Forward AAGTCAGCGGGCCTAAGTAG
    Reverse TGCTCCAGGAAACAACAAACT
  5'UTR-3 Forward TGACTGTGTGAAAAGTGACGT
    Reverse GAACCCGGGTCTCCTTCAT
  5'UTR-4 Forward TTCAGCACTTTCCCCTCTCA
    Reverse CCTCAGCGCCATGTCGAG
  exon 1 Forward TCCATAGCAACCAGACTCGG
    Reverse CGAGACCCTTCCCTGACG
  exon 2-3 Forward CGTCTCTGACTTGGCTTTTCT
    Reverse GGGCCTTCTGTACAAAGAGG
  exon 4-5 Forward TCCTTTAACGGGGAAGCCTT
    Reverse GGTCTGTAGCTCTGGTCTCC
  exon 6 Forward ACATTGTTGGTGTGTTCGGG
    Reverse GAGGCTCAGCAGACACTCA
  exon 7-8 Forward ACAGCATCTTCTCACCCCTC
    Reverse CGTCTCCAGGCTCCCTTAC
  exon 9-1 Forward ATCGAGGGAAGTGGTGTCAG
    Reverse GGTTTCCTAAGCCACCAGTG
  exon 9-2 Forward TGTTCTGCTTTTCTATGGGTGT
    Reverse TGTCTTCATGGCAGAGGGAC
  exon 9-3 Forward AGGAAAAGGCTACCCACTCC
    Reverse GAAAGAAACTGGGCTGGCTC
  exon 9-4 Forward AAAAGGCTACCCACTCCAGT
    Reverse AAAGAAAGGTCAACACAGTCTTG
  exon 9-5 Forward ATGGTCCAGGGCCAAAGG
    Reverse AATGAAGAGGCTGAGCTGCT
  exon 9-6 Forward TGCCATGAGAACTGGTAGCA
    Reverse GACCCACACTCACTCCTCTC
  3'UTR-1 Forward GCTACTAACACACCTGCACG
    Reverse GGGACCCAAGCTTTGTTTCA
  3'UTR-2 Forward CTCCCGTTGCTCTGGTAAAA
    Reverse TGGTGCTCAGAAAGTGGTCA
  3'UTR-3 Forward AGGGAGAGAAGCTGGGAGTA
    Reverse GCGGTTTCCAAGGTACATCC
  3'UTR-4 Forward GGGATGATTGTACATGTGCAGT
    Reverse CTCTGCTACCCGACTGAAGG
SPATA19 5'UTR-1 Forward TGTGCAGATTTAGCGCTTATG
    Reverse CTGTTTCCATCCTTACTGGTG
  5'UTR-2 Forward CAAGGTTGAAGAGACAGGGAAG
    Reverse CTCCCCAGCTTCCCTAAAAT
  5'UTR-3 Forward GCCTAGCATATTCTGATCAATAGAGA
    Reverse CACAAGTGATTCAGATCACAAAAA
  5'UTR-4 Forward TCCTTCACAAGAATTGGCACT
    Reverse TCCATTGAAGCAGCCTGAG
  exon 1 Forward CCAATCAGGTAGGCACCAC
    Reverse CTCTCCACCTAGCCATCACC
  exon 2 Forward TGGATGTGGATAGTGGAGCA
    Reverse TGATGAATCAGACGCAGCTC
  exon 3 Forward GGACCAGACGAGTGAAGGAA
    Reverse CGGCTAACAGGCTCCATTAC
  exon 4 Forward CTTGCTGGGCAGTAACCACT
    Reverse GGTTTGTGTCAGCCAGGAAT
  exon 5 Forward ATCCCAATGCTTGACGATGT
    Reverse GACCCACAGAGACCAGAAGC
  exon 6 Forward CTGCTGTGGTCTGTGCTCTG
    Reverse CCCCTTGCTGGTATTCTCAA
  exon 7 Forward GCATTTCCCTCTTTCCATGT
    Reverse TAGCAAGGCACTCACACCAG
  3'UTR-1 Forward AGTGGCAGCACTGGAATCTT
    Reverse TGTGTAAGGAAAGGACGCACT
  3'UTR-2 Forward GTGACATGTGCGCTTCACTC
    Reverse AAGATCTGGGGGACAATTCC
  3'UTR-3 Forward TTGTTCCTCTCCTGGTTTCC
    Reverse ACAGCTGCCGGAAAGAGTAA
  3'UTR-4 Forward GGCCTTCATCGTGAGGTTTA
    Reverse CTGCAGGAATCCTTCCAGAC

Table 1: Primers used to search for SNPs.

ID 34 55 109 152
Paternal ID 2182318 2183007 2265005 2290977
Maternal ID 769202561 15937840 123597843 128824973
EBV 0.521 0.4807 0.2988 0.2937
Hapmap51018-BTA-65434 G G G G
  G G G G
Hapmap34976-BES2_Contig422_801 G A G G
  A A A G
BFGL-NGS-112928 G G G G
  G G A G
ARS-BFGL-NGS-70760 C C A A
  C C A A
BTA-65424-no-rs A A A A
  A A A A
BFGL-NGS-109714 A A A A
  G G G A
ARS-BFGL-NGS-62183 C A A A
  C A A A
BTB-01020010 G A A G
  G G G G
BFGL-NGS-110219 A A G G
  G G G G
Hapmap40017-BTA-65421 C C A A
  C C C A
ARS-BFGL-NGS-36127 A A A A
  A A A A
UA-IFASA-7281 G G A A
  G G A A
ARS-BFGL-NGS-87575 G G A A
  A G A A
ARS-BFGL-NGS-12309 G G A A
  G G A A
BTA-65417-no-rs G G A G
  G G G G
UA-IFASA-7219 A G A A
  A A A A
ARS-BFGL-NGS-1333 A A G G
  A A G G
BTA-65410-no-rs A G G G
  G G G G
UA-IFASA-8767 G A A A
  G A A A
UA-IFASA-9430 A G A A
  A A A A
Hapmap48423-BTA-65404 A G A A
  A A A A
BFGL-NGS-119359 G G G G
  G G G G
ARS-BFGL-NGS-16031 A A G G
  A A G A
Hapmap58618-rs29012371 G G A G
  G A A A
BTA-65537-no-rs A A A A
  G G G A
BFGL-NGS-117839   G G G
    A A A
BTB-01023253 A G A A
  G G A G
ARS-BFGL-NGS-102550 A G A A
  A A A A
ARS-BFGL-NGS-24769 G G G G
  G G G G
ARS-BFGL-NGS-41631 A A A A
  A A A A
BFGL-NGS-115193 A A A A
  G G G A
Hapmap52938-rs29027128 A A A A
  A A A A
ARS-BFGL-NGS-40178 G G G G
  G A G G
BTA-65587-no-rs A A A A
  A A A A
UA-IFASA-8226 G A A A
  A A A A

Table 2: Samples used for developing new SNPs.

Allelic substitution effects

We genotyped 2,682 cows and 4,165 bulls for FLI1, PKP2, CTTNBP2NL, SETD6, CACNB2, UNC5C, and FAM213A. FLI1 was identified as a gene that was associated with the CR in the present study. PKP2, CTTNBP2NL, SETD6, CACNB2 and UNC5C have previously been identified as genes associated with the CR, whereas FAM213A has previously been identified as a gene that was associated with the fertility selection index (SI) [12-14]. The SI consists of the EBVs for days open (DO), the number of inseminations per lactation (NI), success after first insemination (SFI), and pregnancy within 70 d (P70), 90 d (P90), and 110 d (P110) after delivery [15]. The EBVs of cows and bulls with these six traits included in the SI were estimated by an animal model using 1,881,898 records. The EBVs of cows and bulls in relation to the CR were estimated by a thresholdlinear repeatability animal model using 3,428,666 values after first parturition. The data were collected between January 1990 and September 2015 by the dairy herd improvement program of Hokkaido, Japan. The allelic substitution effects of these genes were determined using the following equation:

Equation

where yi = the deregressed EBV [16] of animal i (= 1, 2, …, n) for the CR, DO, NI, SFI, P70, P90, P110 or SI; μ = the general average value of the population; χij= the genotype covariate (coded as 0 or 2 for the two homozygotes and 1 for heterozygotes) of gene j in animal i; gj = the random regression coefficient representing the allelic substitution effect for gene j; and ei = the random residual effect for the value of animal i. We performed the analyses with the SAS MIXED procedure.

Real-time PCR

RNA was extracted from individual samples of bovine brain, heart, kidney, liver, lung, ovary, pancreas, skeletal muscle, spleen, stomach, and uterine tissue using TRIzol reagent (Life Technologies, Carlsbad, CA, USA). Real-time PCR was conducted with an ABI 7900HT Sequence Detection System using the comparative Ct method and glyceraldehyde-3- phosphate dehydrogenase (GAPD) as an internal control (Life Technologies). The primers used in these assays are shown in Table 3.

Gene Primer Sequence
FLI1 Forward Reverse Probe CGTCAAGCGCGAGTACGA TGCCGCATTTGCTGACACT TGGGTCCAGGGAGTCTCCGGTG
GAPD Forward Reverse Probe GCCCTCAACGACCACTTTGT CCTGTTGCTGTAGCCAAATTCA AAGCTCATTTCCTGGTACGA

Table 3: Primers used for real-time PCR.

Luciferase assay

Fragments of the 5’UTR of FLI1 were generated using PCR with the respective forward and reverse primers (Table 4). These PCR products were further amplified via PCR using the forward2 and reverse2 primers (Table 4) to be cloned into a pGL3 (R2.2)-basic vector (Promega, Madison, MI, USA) using an In-Fusion Advantage PCR Cloning Kit (Takara Bio Inc., Shiga, Japan). Luciferase assays were performed using a Dual- Luciferase Reporter Assay System (Promega).

Primer Sequence
Forward TATATAGTGTGTGTGATGCG
Reverse TTGGCCAAGTCTGCAGCCGA
Forward2 CCGAGCTCTTACGCGTTATATAGTGTGTGTGA
Reverse2 CTTAGATCGCAGATCTTTGGCCAATCTGCAG

Table 4: Primers used for generating reporter constructs.

SNaPshot and quantitative analysis of allele ratios

The allelic messenger RNA (mRNA) ratio was determined using a SNaPshot Multiplex Kit (Life Technologies), and the primers used are shown in Table 5. For cDNA preparations, each mRNA was converted to cDNA in three separate experiments.

Primer Sequence
Forward TATATAGTGTGTGTGATGCG
Reverse CTTTGCGAATGGGGAGGAAG
Extension GCGCGAGACAGAGAGAGAGAGAGAGAGAGAGA

Table 5: Primers used for SNaPshot.

Enzyme immunoassays

The concentration of perforin released from the bovine serum was assayed using a Perforin Human ELISA Kit (Abcam, Cambridge, UK) according to the manufacturer’s instructions.

Embryo transfer to recipient female

The embryos were transferred non-surgically into Holstein heifers to the uterine horn ipsilateral to the existing corpus luteum using an embryo transfer device (Misawa Medical Industry Co., Ltd, Tokyo, Japan) on days 6–8 of the estrous cycle. Pregnancy was determined by real-time B-mode ultrasonography (Honda electronics Co. Ltd., Toyohashi, Japan) on days 30 and 60 of gestation. Calves were delivered spontaneously without induction of parturition.

Results

Our GWAS identified ARS-BFGL-NGS-12309 as the most significantly associated SNP on chromosome 29 (Figure 1B), and the region associated with this SNP included 6 genes (Figure 2A). To detect possible causative polymorphisms in this region, we sequenced all exons and the 5’ and 3’ UTRs of these 6 genes and found 35 novel SNPs (Figure 2A). A reanalysis of the newly sequenced SNPs demonstrated that FLI1 (GA-266del) was the most significant (Figure 2A). Moreover, we genotyped FLI1 (GA-266del) in 2,682 cows and 4,165 bulls and found that the allele substitution effect of FLI1 on the dEBV for the CR was 0.44 (Figure 2B). Cows with the GA/GA genotype exhibited a 0.44 higher CR than those with the GA/del genotype. FLI1 also had favourable effects on the dEBV for the traits that compose the SI (DO, NI, SFI, P90, and P110) and the SI itself. The effects of FLI1 were similar to those of PKP2, SETD6, CACNB2, UNC5C, or FAM213A, which have previously been identified to be associated with the CR or SI in the Japanese dairy cow population [12-14] (Figure 2B). Therefore, FLI1 (GA-266del) was the most promising causative SNP on chromosome 29 and had a similar impact on the CR as the five genes previously identified to be associated with CR or SI.

reproductive-immunology-quantile-quantile-plot

Figure 1b: A quantile-quantile plot of the GWAS for the CR. The equiangular line (black line) is included in the plot for reference purposes. The dashed horizontal line indicates the threshold for genome-wide significance (assuming a Bonferroni correction) for the 54,035 single nucleotide polymorphisms (SNPs) tested. ARS-BFGL-NGS-12309 is the SNP most significantly associated with the CR on a genomewide level.

reproductive-immunology-FLI1-SNP-associated

Figure 2: FLI1 SNP is associated with the CR. A. Association signals on chromosome 29 with the CR using plots of the P values from the EMMAX analysis. The black line represents the threshold for genome-wide significance after applying the Bonferroni correction for multiple comparisons. ARSBFGL- NGS-12309 was the first significantly associated SNP that was detected, whereas FLI1 (GA-266del) was the most significantly associated novel SNP. Blue circles represent the positions of the 35 newly sequenced SNPs. Blue lines represent 6 genes located in the associated region. The triangle diagram represents pairwise linkage disequilibrium (LD) in the associated region, which was visualized using Haploview [17]. Red shades indicate strong LD. B. The allelic substitution effects of FLI1, PKP2, CTTNBP2NL, SETD6, CACNB2, UNC5C, and FAM213A on the deregressed EBV [16] for CR, days open (DO), number of inseminations per lactation (NI), and success after first insemination (SFI), pregnancy within 70 d (P70), 90 d (P90), and 110 d (P110) after delivery or fertility selection index (SI). n. s.: nonsignificant. * and **: p < 0.05 and p < 0.01, respectively.

FLI1 (GA-266del) is located in the 5’UTR of FLI1 and may influence the expression level of this gene. Because FLI1 is expressed in several bovine tissues, including the uterus (Figure 3A), we used BEnEpC derived from bovine uterine tissue to assess luciferase activity. Reporters carrying the GA allele exhibited higher activity than those carrying the del allele (Figure 3B). Consistent with the results of the luciferase assay, the level of mRNA generated in the presence of the GA allele was higher than that produced in the presence of the del allele according to the allelic mRNA ratio measured in the bovine uteruses (Figure 3C). Consequently, the FLI1 expression level might affect CR in cattle.

reproductive-immunology-genomic-DNA-shown

Figure 3: The FLI1 5’UTR SNP controls its expression level. A. FLI1 expression levels in bovine tissues, as determined via real-time PCR. B. The relative luciferase activity of the 5’UTR region of FLI1 in BEnEpC. The data are presented as the means ± SEM (n=6). The p-value was calculated using Student’s t-test. C. The average allele-specific mRNA expression level of FLI1 ± SEM in the two heterozygous bovine uteruses based on SNaPshot (n = 3). The ratios of GA to del relative to the genomic DNA are shown.

The reduced expression of Fli1 in mice increased numbers of NK cell [2] and NK cells were involved in the acceptance of the fetus to the mother through perforin-dependent pathway [5]. Thus cows with the reduced expression of FLI1 might show high concentration of perforin and low CR. To explore the possibility, we examined the FLI1 genotypes and their perforin concentration in cows. As expected, the serum concentrations of perforin of cows carrying del/del were higher than those of cows carrying GA/GA (Figure 4A). Moreover, we found a relationship between the FLI1 genotype and outcome of embryo transfer (Figure 4B). 33 cows carrying GA/GA were pregnant after one trial of embryo transfer (Successful) while only 1 cow carrying GA/GA was not pregnant after three trials of embryo transfer (Unsuccessful). On the other hand, 16 out of 191 cows carrying del/del were unsuccessful. The chi-square statistic for the distribution of FLI1 variants gives a p-value of 0.038. Therefore, the reduced expression of FLI1 increased perforin production, which might decrease CR through inhibiting to accept the embryo to the recipient.

reproductive-immunology-three-trials-embryo-transfer

Figure 4: Cows with GA/GA showed lower levels of perforin compared with cows with del/del. A. The serum concentrations of perforin of GA/GA or del/del cows at approximately day 9 of the estrus cycle. The p-value was calculated using Student’s t-test. B. Distribution of FLI1 variants in cows successful or unsuccessful for pregnancy after embryo transfer. Successful means that the cow was pregnant after one trial of embryo transfer while unsuccessful means that the cow was not pregnant after three trials of embryo transfer.

Discussion

The present study is the first to demonstrate that FLI1 modulates CR. Analyzing the whole genome of 2,559 Holstein sires identified a novel mutation associated with the CR. Although we have previously identified several genes associated with the CR in the Japanese Holstein female population [12,13], FLI1 is a novel gene associated with CR, which has previously been known as a proto-oncogene and belongs to the ETS gene family of transcription factors [1]. One of the reasons for this GWAS result might be that we scanned the whole genome of sires whose EBVs for traits are more precise than females because of their large number of offspring. A second reason might be that we analyzed all of the 2,559 samples rather than comparing two groups of samples carrying the extremes of CR.

We found that the SNP in the 5’UTR of FLI1 is correlated with CR. The region including the SNP identified is not predicted to be a binding site of transcription factor (TRANSFAC 7.0, https://www.gene-regulation.com/pub/datab ases.html), however, it might affect interaction with an unknown nuclear protein [18]. cis-Acting polymorphisms would affect transcription, mRNA processing, mRNA stability, and protein translation [19]. Several GWAS reported that SNPs located in 5’UTR of the genes were associated with a broad range of phenotypes [20-22]. Since the polymorphism in the 5’UTR of FLI1 influences its expression level (Figures 3B and 3C), the associated genetic variant should harbor the functional effect and affect the phenotype.

Several studies implicate that oncogenes play an important role in fertility [23,24]. One example is pleomorphic adenoma gene 1 (PLAG1) known as an oncogene associated with pleomorphic adenomas of the salivary gland, which belongs to the PLAG family of zinc finger transcription factors [25]. The study of Plag1 knockout mice suggests that PLAG1 deficiency causes growth retardation as well as reduced fertility [26]. GWAS in humans and domestic animals indicated that polymorphisms in the PLAG1 genomic region were associated with body growth and reproductive traits [27,28]. Possible mechanisms linking PLAG1 to reproductive physiology could be related to growth hormone (GH) and insulin-like growth factor (IGF) 1 or 2 signalling [24]. Interestingly, IGF1 is a target gene of FLI1 [29]. Moreover, administering of bovine somatotropin to dairy cows increased plasma concentrations of GH and IGF1 and enhanced conceptus size and fertility [30]. FLI1 might influence CR through GH and IGF1/2 signalling as well as PLAG1.

We demonstrated here that the polymorphism in FLI1 affected the serum concentration of perforin (Figure 4A). In cattle, perforin was highly expressed in the peri-implantation endometrium, suggesting that it may play important roles in the establishment and maintenance of gestation during normal pregnancy in ruminants [31]. By producing perforin, uterine NK cells act as a double-edged sword at the maternalfetal interface to protect the host from the pathogens and along with apoptosis of fetus [6]. In dairy cattle, infection of the mammary gland is associated with a reduction in pregnancy rate and an increase in the number of inseminations required to establish pregnancy [32], suggesting that activation of the immune system by infection inhibits pregnancy. Keeping the appropriate level of perforin would be critical for normal pregnancy in ruminants as well as other mammals.

Several reports inferred the link between immunity and female fertility. The long pentraxin 3 is produced by innateimmunity cells in response to proinflammatory signals and acts as a predecessor of antibodies, but it is also essential in female fertility by acting as a nodal point for the assembly of the cumulus expansion [33]. Peroxisome proliferator-activated receptor gamma regulates immune cell activation and facilitates the release of oocytes each estrous cycle [34]. FLI1 might have dual roles for controlling NK cell population and CR.

In conclusion, the present study investigated the whole genome in 2,559 samples, and a significant association was observed between CR and FLI1 with a polymorphism in 5’UTR. Further functional studies revealed that this SNP was correlated with the expression of FLI1, the concentration of perforin, and the outcome of embryo transfer. These results indicate that FLI1 plays a role in female fertility in cows.

Acknowledgments

The authors thank K. Maruyama for performing extensive genotyping.

Funding

This work was supported by a grant from the Ministry of Agriculture, Forestry and Fisheries of Japan (Research Program on Innovative Technologies for Animal Breeding, Reproduction, and Vaccine Development, AGB-2004).

References

Select your language of interest to view the total content in your interested language

Viewing options

Flyer image

Share This Article

paper.io

agar io

wowcappadocia.com
cappadocia-hotels.com
caruscappadocia.com
brothersballoon.com
balloon-rides.net

wormax io