Association of BCL11A Genetic Polymorphisms with Fetal haemoglobin Level in Sudanese Patients with Sickle Cell Anaemia

Shireen Zuhdi Nimer1*, Elshazail Widaa Ali1 and Hiba Khalil2

1Faculty of Medical Laboratory Sciences, Alneelain University, Sudan

2Alneelain Stem Cell Center, Alneelain University, Sudan

*Corresponding Author:
Shireen Zuhdi Nimer
Faculty of Medical Laboratory Sciences
Alneelain University, Sudan
Tel: 00966531546162
E-mail: shereen.almaaas100@gmail.com

Received Date: April 23, 2019 Accepted Date: May 23, 2019 Published Date: May 30, 2019

Citation: Shireen ZN, Elshazali WA, Hiba K (2019) Association of BCL11A Genetic Polymorphisms with Fetal haemoglobin Level in Sudanese Patients with Sickle Cell Anaemia. J Genom Gene Study Vol.2 No.1:2

Visit for more related articles at Journal of Genomics & Gene Study

Abstract

Background: Fetal Hemoglobin (HbF) level is the major genetic modulator of the hematologic and clinical features of sickle cell anaemia. Fetal hemoglobin genes are regulated genetically. Recently, the BCL11A gene was identified as a regulator of HbF level. The aim of this study to investigate the association of BCL11A genetic polymorphisms (rs11886868) with HbF Level in Sudanese patients with sickle cell anaemia (Hb SS).

Materials and Methods: A cross-sectional observational study included 71 Sudanese patients with sickle cell anemia (Hb SS). Patients under hydroxyurea and those with a history of blood transfusion for at least three months were excluded. Genotyping for rs11886868 was determined using PCR/Sequencing. Fetal hemoglobin level for each patient was quantified and it was compared with Genotype and allele frequencies.

Results: Genetic variants were detected on BCL11A gene rs11886868, rs766432, rs144866206, rs766431. Genotype of rs1886868 and rs766432 found to have a statistically significant effect on the HbF level (p-value <0.0001), rs766432 (p-value 0.042) and also found to have significant effects on the clinical severity of sickle cell anaemia, but rs144866206 and rs766431 showed a statistically insignificant association on HbF level (p-value 0.173 and 0.546respectively).

Conclusion: The BCL11A genetic polymorphisms (rs11886868, rs766432) in Sudanese patients with sickle cell anaemia were associated with HbF levels and complication of this disease.

Keywords

Sickle cell anaemia; Fetal haemoglobin; Polymorphism of BCL11A

Introduction

Sickle Cell Anaemia (SCA) is autosomal recessive genetic haemoglobinopathy disorders [1]. Worldwide, more than 300 000 infants are born with sickle cell disease each year, takes place nearly 67% in Africa [2]. Sickle cell anaemia is caused by one point mutation in the beta chain of haemoglobin, is caused by the substitution of an Adenine (A) for a Thymine (T) in the sixth codon of the beta-globin gene, leading to the substitution of glutamic acid for valine and to the production of Haemoglobin S (HbS) [3]. Sickle cell anaemia affects the structure of erythrocytes by altering the normal biconcave shape of a crescent. During this process, the hemoglobin S (HbS) mutation leads to haemoglobin polymerization and deoxygenation, resulting in sickling, abnormal adhesion of leukocytes and platelets, inflammation, hypercoagulation, hemolysis, and hypoxia, in addition to microvascular obstruction and finally organ damage [4]. One important factor that has been described as influencing the clinical course and hence disease severity in the SCA is fetal Hemoglobin F level (HbF) [5]. The levels of fetal Hemoglobin F (HbF) influence the severity of sickle cell anaemia, due to its ability to inhibit HbS polymerization. Fetal hemoglobin genes are regulated genetically. Genetic studies have identified three major quantitative trait loci (QTLs) (Xmn1-HBG2, HBS1L-MYB intergenic region on chromosome 6q23, and BCL11A on chromosome 2p16) that account for 20-50% of the common variation in HbF levels in patients with SCA. BCL11A is regulated and maintain HbF silencing in human adult erythroid cells [6]. The BCL11A protein occupies sites within the Locus Control Region (LCR) and intergenic regions of the β-globin locus. Interestingly, all the reported significant Single Nucleotide Polymorphisms (SNPs) of BCL11A reside within a region of 14 kb in intron 2 of the BCL11A gene [7,8]. Determine the effect of Single Nucleotide Polymorphisms (SNPs) in BCL11A with HbF level variation in sickle cell patients will be beneficial to improve the prediction of one's ability to produce HbF. This study aimed to investigate the association of BCL11A genetic polymorphisms (rs11886868) with HbF level in Sudanese patients with sickle cell anaemia.

Material and Methods

Samples and clinical data

This study was a cross sectional observational included Sudanese patients with sickle cell anaemia (Hb SS) attend at the Ahmad Kassem hospital in Khartoum, in 2017, we excluded patients under hydroxyurea and those with a history of blood transfusion for at least three months. This study was approved by the Faculty of Medical Laboratory Sciences, Alneelin University, and informed consent was taken from each participant before sample collection for children, the consent was taken from their parents. Clinical data was extracted from parents and medical files. It is included age, gender and complications. Venous blood samples were collected from each patient for all subjects in EDTA blood tube for haematological and molecular analysis. Complete Blood Count (CBC) was performed by automated haematology analyzer (Sysmex KX21N, Japan), and HbF level was measured by automation capillary electrophoresis (Sebia minicap, France).

DNA extraction and PCR

The genomic Deoxyribonucleic Acid (DNA) extraction was from whole blood samples using (G-spin TM Total Kit –INtRON, Korea) according to the manufacturer’s protocol. The identification of polymorphisms on the BCL11A gene was performed by (PCR) amplification of these gene regions: rs11886868 using primers Forward: CACACCATGGATGAATCCCAGA and Reverse: TGGTGCTACCCTGAAAGACGG. Polymerase Chain Reaction (PCR) was performed on a volume of 20 μL consisted of 3 μL genomic DNA template, 2 μL forward and reverse primer and 15 μL distilled water, added to master mix ready to use (iNtRON Biotechnology, Korea). The thermo cycling condition of PCR were 35 cycles of denaturation (95°C for 30 seconds), annealing (61°C for 60 sec), and extension step (72°C for 90 sec). A preheating step at (95°C for 10 minutes) and final extension step for (7 min at 72°C). The PCR product separated using 2% agarose gel electrophoresis and visualized with ethidium bromide and fragments were visualized by use of the gel documentation system (Syengene, Japan).

DNA sequence analysis

PCR products were then purified and doubly sequenced (forward and reverse), sequencing was based on Sanger’s chain termination method by Beijing Genomic Instituted (BGI), China.

Bioinformatics analysis

The chromatogram sequences were visualized through Finch TV program version (1.4.0). Reference sequences of the BCL11A gene have accession numbers NG_01196. Were retrieved from NCBI (https://www.ncbi.nlm.nih.gov/) and subjected to multiple sequence alignment using Bio Edit software version (7.2.5.0).

Data analysis

Patients' hematological and clinical data and together with molecular data were analyzed by the Statistical Package for Social Sciences (IBM SPSS statistics for windows, version 22.0).

Results

Overall, 71 patients with sickle cell anaemia (HbSS) were enrolled; 38 (54%) of them were males and 33 (46%) were females. Patients' ages were ranged from 1 to 16 years (Mean ± SD: 6.42 ± 4.32). In general, the HbF level was ranged between 1% and 35.7% (Mean ± SD 11.3 ± 7.5). Table 1 summarizes the description of demographic, hematological and clinical data of patients with sickle cell anaemia (HbSS). In this study, the total of 4 genetic variants was detected on BCL11A gene rs11886868, rs766432, rs144866206, rs766431. Mutations positions and allele frequencies for each mutation was displayed in Table 2.

Frequency Percentage (%) Mean ±SD of HbF p-value
Gender
Male 38 (54%) 9.95±6.80 0.104
Female 33 (46%) 12.86±8.03  
Age in years
1-5 36 50.7% 12.76±8.51  
6-10 21 29.6% 10.77±6.05 0.008
>10 14 19.7% 8.35±6.08 R=-0.312
complication
Yes 58 (82%) 9.425±.69  
no 13 (18%) 19.70±9.11 < 0.0001
Degree of anaemia
Moderate anaemia 41 (59%) 13.87±8.41 0.019
Severe anaemia 29 (41%) 9.63±6.44  

Table 1: Hematological, demographic, and clinical data of studied population.

SNP Allele change Chr:position Minor Allele Factors
rs11886868 G → A 2: 65388 0.35 (G)
rs766431 C → T 2: 65426 0.01 (T)
rs766432 G → T 2: 65664 0.37 (G)
rs144866206 T → C 2: 65717 0.12 (C)

Table 2: Frequencies of the genotypes of the BCL11A variants

The minor allele in the rs11886868 and rs766432 was “G”, accounting for (35% and 37% respectively) of the total chromosomes. The minor allele" G” was associated with increased HbF levels and genotypes containing the minor allele exhibited significantly high of HbF levels. In 44866206 had 12% of minor allele” C”. Allele "C” increased the Hb-F levels in genotypes, but statically insignificant. Genotype distribution in Tables 3 and 4.

rs11886868 GG GA AA p-value
Hb-F 15.7 ± 8.5 14.7 ± 8.11 7.89 ± 4.79 <0.0001
rs766431 CC CT -  
Hb-F 11.21 ± 7.37 14.50 ± 10.41 - 0.546
rs766432 GG GT TT  
Hb-F 15.80 ± 9.47 10.21 ± 7.42 10.19 ± 5.52 0.042
rs144866206 TT TC CC  
Hb-F 10.44 ± 7.46 14.02 ± 7.30 14.20 ± 6.78 0.173

Table 3: Mean of HbF levels in SCA patients across polymorphism

Genotype Complication p-value OR (CI L-CI Up)
  Yes No
rs766432
GG 8 (14%) 6 (46%)    
GT 21 (36%) 25 (31%) 0.024 1.9 (0.15-25.2)
TT 29 (50%) 3 (23%) 0.008 1.8 (0.12-6.7)
rs144866206
TT 48 (83%) 7 (54%)    
TC 9 (15%) 6 (46%) 0.048 0.234 (0.12-0.67)
CC 1 (2%) 0 (0.0%) 0.024 0.45 (0.32-0.87)
rs766431
CC 56 (97%) 13 (100%) 0.656 0.81 (0.72-0.91
CT 2 (3%) 0 (0.0%)    
rs11886868
GG 10 (17.2%) 6 (46.2%)    
GA 14 (24.1%) 3 (23.1%) 0.468 1.82 (0.36-9.22)
AA 34 (58.6%) 4 (30.8%) 0.027 5.10 (1.19-21.7)

Table 4: Distribution of genotype frequencies and allele frequencies of SCA patients according to complication

Discussion

Patients with sickle cell anaemia, typically demonstrate clinical phenotypes whose severity is inversely proportional to the degree of preservation of HbF expression. Polymorphisms of BCL11A are one of the most important factors in variation in HbF levels in patients with SCA. Several SNPs have been identified in BCL11A intron-2 as the most highly associated with the HbF level in African people, including rs11886868 [9]. These SNPs lie within an erythroid enhancer and act combinatorial to influence BCL11A regulate [10]. Also, our study in the Sudanese patients showed rs11886868 was associated with HbF levels. Additionally, this study detected another independent effect of SNPs (rs766432, rs766431 and rs144866206) on HbF Levels. The rs11886868 genotype has a wide distribution that varies in populations throughout the world. In this study, the minor allele frequency "G" of rs11886868 (0.35) a statically significant with increased HbF levels (p-value<0.0001) has a similar frequency with the populations of Cameron and Tunis and African Americans. Allele "G" is widespread in Indonesia and Sardinians (0.88) [11]. The difference in the frequency of variant genotype might be on account of ethnic differences. Our study indicates that the minor allele "G" in rs766432 has a frequency (0.37) agree with various populations, including whites in Europe, the population of white Americans, and Asian populations and associated with increased HbF levels [12]. The minor allele frequency "C" in rs766431 and "T in "rs144866206 was (0.12 and 0.01 respectively) these alleles increase HbF, but no statically significant (0.173 and 0.546 respectively), while in rs144866206 genotypes (CT and CC) containing mutant allele C was statically significant with complication and severity disease (p-value=0.048 and 0.024). The association of" C" in rs766431 and "T " in rs144866206 in BCL11A in SCA patients, not mentioned in any previous studies for comparison.

The results of this study are capable of correcting the underlying cause of the disease, alleviate its symptoms and offer the opportunity to therapy, and that is done by Gene Therapy (GT) based on autologous transplantation of genetically modified stem cells is a promising therapeutic option for patients with sickle cell aneamia. The objective of the therapy is the introduction of nucleic acids into cells that will modify gene expression in order to prevent, halt, or reverse the pathological process. Gene therapy is done with different strategies (e.g. CRISPR/Cas system).

Conclusion

The present study revealed that genotypes for SNPs (rs11886868 and rs766432) in the BCL11A gene were associated with HbF levels and complications in sickle cell anemia. This is finding can help improve the treatment of patients with SCA complications and help to improve the prediction of one’s ability to produce HbF and future treatment of sickle cell anemia.

Acknowledgment

We wish to express my deepest appreciation to Dr. Hisham N. Altayb for his help and support in bioinformatics part.

References

Select your language of interest to view the total content in your interested language

Viewing options

Flyer image

Share This Article

slot gacor