iMedPub | Insight Medical Publishing http://www.imedpub.com/ iMedPub LTD is a new approach to scientific publishing. As an open service to scientists, it is driven by researchers for researchers, while serving the interests of the general public. http://raredisorders.imedpub.com/current-issue.php Journal of Rare Disorders: Diagnosis & Therapy Volume 5, Issue 3 http://raredisorders.imedpub.com/rare-malignant-tumors-in-mexican-pediatric-patients-a-cooperative-pediatric-oncology-research-group-report.php?aid=24672 Rare Malignant Tumors in Mexican Pediatric Patients A Cooperative Pediatric Oncology Research Group Report Norma Araceli LoacutepezFacundo, Liliana VelascoHidalgo, Farina Esther ArreguiacutenGonzaacutelez, Daniel OrtizMorales, Mayra LoacutepezRuiz, Marco Rodrigo AguilarOrtiz, Daniela CovarrubiasZapata, Lourdes VegaVega, Eduardo Jorge BantildeosRodriacuteguez, Perla Citlali SimoacutenGonzaacutelez, Isidoro TejocoteRomero, Laura GarciacuteaSegura, Cynthia Shanat CruzMedina, Gina Patricia De Gasperin Estrada, Marcela ArsuagaJimeacutenez M, Karen Giovana Mejiacutea, Daniela OlveraCaraza D and Marta ZapataTarreacutes M http://archivosdemedicina.com/current-issue.php Archivos de Medicina Volume 15, Issue 3 http://www.archivosdemedicina.com/medicina-de-familia/hipotiroidismo-subcliacutenico-un-diagnoacutestico-olvidado.php?aid=24646 Hipotiroidismo Subcliacutenico Un Diagnoacutestico Olvidado Joseacute de Jesuacutes Bohoacuterquez Rivero and Milton Manuel Rivera Moreno http://www.archivosdemedicina.com/medicina-de-familia/influencia-de-la-modificacioacuten-de-haacutebitos-alimenticios-con-la-inclusioacuten-de-aceite-de-aguacate-sobre-el-control-gluce.php?aid=24645 Influencia de la Modificacioacuten de Haacutebitos Alimenticios con la Inclusioacuten de Aceite de Aguacate Sobre el Control Gluceacutemico de Pacientes Diabeacuteticos en Tinajas ColimaMeacutexico Maria Evangelina Alvarez Salazar, Ana Estephania Reyesmendoza, Rauacutel Loacutepez Ascencio and Clemente Vaacutesquez http://pancreas.imedpub.com/current-issue.php JOP. Journal of the Pancreas Volume 20, Issue 4 http://pancreas.imedpub.com/prediction-of-clinically-relevant-pancreatic-fistula-in-the-early-phase-after-distal-pancreatectomy.php?aid=24627 Prediction of Clinically Relevant Pancreatic Fistula in the Early Phase after Distal Pancreatectomy Kazuhiro Suzumura, Kenjiro Iida, Hideaki Iwama, Yusuke Kawabata http://pancreas.imedpub.com/acute-pancreatitis-two-attacks-with-normal-serum-amylase-and-lipase-a-rare-case-report.php?aid=24615 Acute Pancreatitis Two Attacks with Normal Serum Amylase and Lipase A Rare Case Report Santo A Carnazzo, Andrea Musumeci, Rosalia Latino, Paolo D Cannizzaro http://pancreas.imedpub.com/progress-in-animal-models-of-pancreatic-ductal-adenocarcinoma.php?aid=24614 Progress in Animal Models of Pancreatic Ductal Adenocarcinoma Kaiwen kong, Meng Guo, Yanfang Liu, Jianming Zheng http://ijddr.in/current-issue.php International Journal of Drug Development and Research Volume 11, Issue 3 http://www.ijddr.in/drug-development/agtctcttcttctcagtgcgcaaatpreclinicalstudies-of-neast-neutralizing-equine-antishiga-to-xin-apotential-treatment-for-prevention-of-s.pdf AGTCTCTTCTTCTCAGTGCGCAAATPreclinicalStudies of NEAST Neutralizing Equine AntiShiga To xin APotential Treatment for Prevention of StecHus Hiriart Yanina, Pardo Romina, Bukata Lucas, Laucheacute Constanza, Muntildeoz Luciana, Berengeno Andrea L, Colonna Mariana, Ortega Hugo H, Goldbaum Fernando A, Sanguineti Santiago and Zylberman Vanesa http://www.ijddr.in/drug-development/molecular-study-of-vancomycin-resistance-in-hospital-acquired-staphylococcus-infection.pdf Molecular Study of Vancomycin Resistance in Hospital Acquired Staphylococcus Infection Maysaa ElSayed Zaki, Aalaa Abouelnour, Sherif MH ElKannishy and Rasha Hassan http://www.ijddr.in/drug-development/microencapsulation-of-solid-dispersions-of-felodipine-andcharacterization-of-release-mechanism.pdf Microencapsulation of Solid Dispersions of Felodipine andCharacterization of Release Mechanism Alap A Choudhari, Anil M Pethe, Manoj S Charde, Asmita A Durugkar and Sidheshwar B Joshi http://www.jneuro.com/current-issue.php Journal of Neurology and Neuroscience Volume 10, Issue 4 http://www.jneuro.com/neurology-neuroscience/cyberpsychology-a-rapid-overview-of-sexting.php?aid=24683 Cyberpsychology A Rapid Overview of Sexting Fuensanta LopezRosales, Joseacute Luis JassoMedrano, and Faustin Armel Etindele Sosso http://www.jneuro.com/neurology-neuroscience/a-registry-of-maternal-and-fetal-outcomes-in-pregnant-epileptic-women-from-pakistan.php?aid=24682 A Registry of Maternal and Fetal Outcomes in Pregnant Epileptic Women from Pakistan Maimoona Siddiqi, Qamar Zaman, Nadia Mehboob and Salman Mansoor http://www.jneuro.com/neurology-neuroscience/physiological-correlates-of-arousal-a-metaanalyticreview.php?aid=24681 Physiological Correlates of Arousal A MetaanalyticReview Dhruv Beri and Jayasankara Reddy K http://www.jneuro.com/neurology-neuroscience/severe-guillainbarr-syndrome-following-shingrix-vaccine-administration.php?aid=24680 Severe GuillainBarr Syndrome Following Shingrixsupsup Vaccine Administration Rina Yadav, Drew Hundley and Lannie Cation http://www.jneuro.com/neurology-neuroscience/a-patient-with-upper-cervical-spinal-cordinfarction-presenting-with-the-sudden-onsetof-severe-occipital-headache-followed-byoccipi.php?aid=24578 A Patient with Upper Cervical Spinal CordInfarction Presenting with the Sudden Onsetof Severe Occipital Headache Followed byOccipital Neuralgia Hisashi Ito, Ai Seki, Shigeru Fukutake, Sanae Odake, Terunori Sano, Yuji Uchida, Hiroshi Kitahara and Tetsumasa Kamei http://hsj.gr/current-issue.php Health Science Journal Volume 13, Issue 4 http://www.hsj.gr/medicine/the-practically-wise-medical-teacher-medical-education-at-the-university-of-troms-a-norwegian-case.php?aid=24670 The Practically Wise Medical Teacher Medical Education at the University of Tromsoslash ndash A Norwegian Case Sylvi Stenersen Hovdenak, Ida KR Hatlevik, Kristian Bartnes, IngerHeidi Bjerkli, Stig Norderval and Tone Nordoslashy http://www.hsj.gr/medicine/hospital-outbreak-of-respiratory-syncytial-virus-in-neonatal-intensive-care-unit-what-is-the-risk-of-admitting-external-patients.php?aid=24630 Hospital Outbreak of Respiratory Syncytial Virus in Neonatal Intensive Care Unit What is the Risk of Admitting External Patients Lais Bomediano de Souza, Emanuela Ribeiro, Fernando Silva, Marinice Duarte da Ponte, Roberto Carvalho, Hadassa Louback Paranhos, Jose Luis Braga de Aquino, Vania Aparecida Leandro Merhi, Idiberto Joseacute Zotarelli Filho, Elisa Teixeira Mendes http://www.hsj.gr/medicine/practice-of-road-safety-measures-among-kenyatta-university-and-united-states-international-university-students-in-nairobi-county-k.php?aid=24606 Practice of Road Safety Measures among Kenyatta University and United States International University Students in Nairobi County Kenya Chavaregi Hage, Akunga DN and Mogere SN http://www.hsj.gr/medicine/the-wound-dressings-and-their-applications-in-wound-healing-and-management.php?aid=24605 The Wound Dressings and Their Applications in Wound Healing and Management Jun Lei, Lichun Sun, Ping Li, Chenhong Zhu, Zhen Lin, Vienna Mackey, David H Coy and Quanyong He http://www.hsj.gr/medicine/an-evaluation-of-problembased-learning-supported-by-information-and-communication-technology-a-pilot-study.php?aid=24604 An Evaluation of Problembased Learning Supported by Information and Communication Technology A Pilot Study Juniar Ernawaty and Astried Sujono http://www.hsj.gr/medicine/major-approaches-of-orthognathic-surgery-in-obstructive-sleep-apnea-syndrome-a-systematic-review.php?aid=24603 Major Approaches of Orthognathic Surgery in Obstructive Sleep Apnea Syndrome A Systematic Review Rodrigo Nabuco Vancan, Idiberto Jose Zotarelli Filho and Elias Naim Kassis http://www.hsj.gr/medicine/systematic-review-of-major-outcomes-of-tranexamic-acid-in-cardiac-surgery.php?aid=24601 Systematic Review of Major Outcomes of Tranexamic Acid in Cardiac Surgery Maria Christiane Valeacuteria Braga Braile, Sofia Braile Sabino, Giovanni Braile Sternieri, Luiza Braile Verdi, Eliana Migliorini Mustafa, Victor Rodrigues Ribeiro Ferreira, Bethina Canaroli Sbardellini, Cibele Olegaacuterio Vianna Queiroz, Idiberto Joseacute Zotarelli Filho and Domingo Marcolino Braile http://www.hsj.gr/medicine/lunotriquetral-coalition-an-infrequent-cause-of-wrist-pain-a-case-report.php?aid=24568 Lunotriquetral Coalition An Infrequent Cause of Wrist Pain A Case Report Awajimijan Nathaniel Mbaba, Michael Promise Ogolodom, Chidinma Wekhe and Beatrice Ukamaka Maduka http://www.hsj.gr/medicine/sonographic-quantification-of-abdominal-adipose-tissues-thickness-in-hypertensive-obese-yoruba-tribe-in-lagos-state-nigeria.php?aid=24567 Sonographic Quantification of Abdominal Adipose Tissues Thickness in Hypertensive Obese Yoruba Tribe in Lagos State Nigeria Abdul Fatai Kolawole Bakre, Anthony Chukwuka Ugwu and Michael Promise Ogolodom http://www.acmicrob.com/current-issue.php Archives of Clinical Microbiology Volume 10, Issue 3 http://www.acmicrob.com/microbiology/isolation-of-pseudomonas-species-and-extended-spectrum-betalactamase-producing-escherichia-coli-from-retail-imported-mackerel-froz.php?aid=24526 Isolation of Pseudomonas Species and Extended Spectrum betalactamaseproducing emEscherichia coliem from Retail Imported Mackerel Frozen Fishes Sold inAbakaliki Metropolis Iroha IR, Okwuchukwu HN, Moses IB, Nwakaeze AE, Ugbo EN and Ude I Ude http://www.acmicrob.com/microbiology/metalloproteinases-sialidases-and-nadph-oxidases-as-key-enzymes-involved-in-atherosclerosis-development.php?aid=24524 Metalloproteinases Sialidases and NADPH Oxidases as Key Enzymes involved in Atherosclerosis Development Anastasia V Poznyak, Dmitry A Kashirskikh, Victoria A Khotina, Andrey V Grechko and Alexander N Orekhov http://www.fisheriessciences.com/current-issue.php Journal of FisheriesSciences.com Volume 13, Issue 3 http://www.fisheriessciences.com/fisheries-aqua/a-review-on-the-probiotic-effects-on-haematological-parameters-in-fish.php?aid=24562 A Review on the Probiotic Effects on Haematological Parameters in Fish Sakyi Essien Michael, Emmanuel Delwin Abarike, Jia Cai http://www.fisheriessciences.com/fisheries-aqua/fish-smoking-in-ghana-a-review.php?aid=24561 Fish Smoking in Ghana A Review Sakyi Essien Michael, Jia Cai, AmpofoYeboah Akwasi, Aglago Adele http://www.fisheriessciences.com/fisheries-aqua/bioaccumulation-of-some-heavy-metals-in-some-organs-of-three-selected-fish-of-commercial-importance-from-niger-river-onitsha-shelf.php?aid=24499 Bioaccumulation of Some Heavy Metals in Some Organs of Three Selected Fish of Commercial Importance from Niger River Onitsha Shelf Anambra State Nigeria Keziah N Ibemenuga, Faith A Ezike, Moses C Nwosu, Lucy C Anyaegbunam, Ebelechukwu I Okoye, Joseph Effiong Eyo http://www.imedpub.com/asian-journal-of-plant-science-research/current-issue.php Asian Journal of Plant Science & Research Volume 9, Issue 3 http://www.imedpub.com/articles/traits-interrelationships-in-lowland-rice-genotypes-under-rainfed-condition-of-fogera-north-western-ethiopia.pdf Traits Interrelationships in Lowland Rice Genotypes under Rainfed Condition of Fogera North Western Ethiopia Alamir Ayenew, Tiegist Dejene and Fisseha Worede http://www.imedpub.com/articles/a-review-of-improving-theprotein-quality-with-the-composition-of-quality-traits-of-maize-zea-mays-l-grain-and-possible-breeding-te.pdf A Review of Improving Theprotein Quality with the Composition of Quality Traits of Maize Zea mays L Grain and Possible Breeding Techniques Yaregal Damtie http://www.jbiomeds.com/current-issue.php Journal of Biomedical Sciences Volume 8, Issue 2 http://www.jbiomeds.com/biomedical-sciences/morinda-lucida-attenuates-acetaminopheninduced-oxidative-damage-and-hepatotoxicity-in-rats.php?aid=24482 Morinda lucida Attenuates AcetaminophenInduced Oxidative Damage and Hepatotoxicity in Rats Didunyemi MO, Adetuyi BO and Oyebanjo OO http://www.jbiomeds.com/biomedical-sciences/mirna-profiling-in-mcf7-breast-cancer-cells-seeking-a-new-biomarker.php?aid=24417 miRNA Profiling in MCF7 Breast Cancer Cells Seeking a New Biomarker Hussein Sabit, Emre Cevik, Huseyin Tombuloglu, Katrine Farag, Osama AM Said, Shaimaa E AbdelGhany, Amany I Alqosaibi, Huseyin Bekir Yildiz, Ferhad Serag ElDeen, Eman Wagih6 and Mokhtar ElZawahri http://www.jbiomeds.com/biomedical-sciences/investigation-of-antioxidant-potentials-of-acacia-nilotica-ocimum-sanctum-and-alpinia-nigra.php?aid=24409 Investigation of Antioxidant Potentials of Acacia nilotica Ocimum sanctum and Alpinia nigra Hussain F, Md Islam A, Hossain MS and Rahman SMA http://primarycare.imedpub.com/current-issue.php Quality in Primary Care Volume 27, Issue 2 http://primarycare.imedpub.com/how-a-resident-clinic-quality-improvement-initiative-using-patient-health-cards-can-serve-as-a-model-for-improving-patient-care.php?aid=24457 How a Resident Clinic Quality Improvement Initiative using Patient Health Cards can Serve as a Model for Improving Patient Care Andrew J Chin, Gurmat K Gill, Benita M Mathai, Sidrah Saleem, Hoang T Phung, Olabisi T Odukoya, Saadri Rashid, Danilo M Aurelio, Tamar Y Bejanishvili amp Jonathan H Wynbrandt http://primarycare.imedpub.com/quality-assessment-of-family-planning-services-using-direct-observation-and-exit-interview-in-salt-city-jordan.php?aid=24387 Quality Assessment Of Family Planning Services Using Direct Observation And Exit Interview In Salt City Jordan http://ejbio.imedpub.com/current-issue.php Electronic Journal of Biology Volume 15, Issue 2 http://ejbio.imedpub.com/genetic-variation-amongst-four-rabbit-populations-i-nigeria-using-microsatellite-marker.php?aid=24491 Genetic Variation amongst Four Rabbit Populations I Nigeria Using Microsatellite Marker Adewunmi O Omotoso, Olajide Olowofeso, Matthew Wheto, Olajide M Sogunle http://ejbio.imedpub.com/assessment-of-internal-absorbed-dose-in-the-human-abdominal-organs-from-two-renal-radiopharmaceuticals-based-on-experimental-mouse.php?aid=24449 Assessment of Internal Absorbed Dose in the Human Abdominal Organs from Two Renal Radiopharmaceuticals Based on Experimental Mouse Data BentolHoda Mohammadi, Seyed Pezhman Shirmardi, Mostafa Erfani, AA Shokri http://ejbio.imedpub.com/an-overview-of-mechanism-of-egress-of-rbc-from-bone-marrow.php?aid=24382 An Overview of Mechanism of Egress of RBC from Bone Marrow Fatima Zafar, Razia Iqbal, Muhammad Faheem Malik, Muhammad Irfan, Mubashar Hussain http://www.imedpub.com/european-journal-of-experimental-biology/current-issue.php European Journal of Experimental Biology Volume 9, Issue 2 http://www.imedpub.com/articles/profiling-the-nitrogen-efficiency-using-agricultural-engineering-technique-of-yara-als-tractor-senso.php?aid=24531 Profiling the Nitrogen Efficiency Using Agricultural Engineering Technique of YARA ALS Tractor Senso Mohammad Hudzari Bin Haji Razali and Muhammad Nawab Hazim Bin Mohd Azhan http://www.imedpub.com/articles/oral-ld50-of-total-saponins-and-tannins-isolated-from-dialium-guineense-stem-bark.php?aid=24530 Oral LD50 of total saponins and tannins isolated from Dialium guineense stem bark Abu OD, Adeogun EF and Ebhohon SO http://www.imedpub.com/articles/the-role-of-the-gut-in-parkinsons-disease.php?aid=24373 The Role of the Gut in Parkinsons Disease Dominic Worku and Roseanna Matt http://psychopathology.imedpub.com/current-issue.php Acta Psychopathologica Volume 5, Issue 2 http://psychopathology.imedpub.com/prevention-and-psychotherapy-downstreamand-upstream-models-and-methods.php?aid=24285 Prevention and Psychotherapy Downstreamand Upstream Models and Methods Margarida Gaspar de Matos, Tony Wainwright, Tania Gaspar, Janaiacutena Bianca Barletta and Carmen Beatriz Neufeld http://psychopathology.imedpub.com/mental-health-among-syrian-immigrants-in-iraq.php?aid=24283 Mental Health among Syrian Immigrants in Iraq Firouzeh Sepehrianazar , Sara Qader Tilee and Margarida Gaspar de Matos http://www.aclr.com.es/current-issue.php Annals of Clinical and Laboratory Research Volume 7, Issue 2 http://www.aclr.com.es/clinical-research/evaluation-of-interferongamma-interleukin-6-and-interleukin-10-in-tuberculosispatients-in-umuahia.php?aid=24481 Evaluation of InterferonGamma Interleukin 6 and Interleukin 10 in TuberculosisPatients in Umuahia Obeagu EI, Okoroiwu IL, Nwanjo HU and Nwosu DC http://www.aclr.com.es/clinical-research/investigation-of-some-haematological-parameters-in-pregnant-women-with-gestational-diabetes-at-federal-medical-center-owerri-imo-s.php?aid=24412 Investigation of Some Haematological Parameters in Pregnant Women with Gestational Diabetes at Federal Medical Center Owerri Imo State Nigeria Okorie Hope, Obeagu Emmanuel Ifeanyi and Anaebo Queen Braxton N http://www.aclr.com.es/clinical-research/a-jot-of-blood-sends-constable-behind-the-bars-justice-by-dna-profiling.php?aid=24402 A Jot of Blood Sends Constable behind the Bars Justice by DNA Profiling Vaishali B Mahajan, Anjali P Kharade, Deepak Y Kudekar, Bhausaheb P More, Krishna V Kulkarni http://www.aclr.com.es/clinical-research/effects-on-pain-and-mobility-of-a-new-diet-supplement-in-dogs-with-osteoarthritis-a-pilot-study.php?aid=24315 Effects on Pain and Mobility of a New Diet Supplement in Dogs with Osteoarthritis A Pilot Study Elisa Martello, Mauro Bigliati, Donal Bisanzio, Elena Biasibetti, Franco Dosio, Daniela Pastorino, Massimo DeNardi and Natascia Bruni http://www.aclr.com.es/clinical-research/serum-tartrate-resistant-acid-phosphatase-5b-in-beta-thalassemia-egyptian-patients-promising-biomarker-of-iron-overload-oxidative.php?aid=24307 Serum Tartrate Resistant Acid Phosphatase 5b in Beta Thalassemia Egyptian Patients Promising Biomarker of Iron Overload Oxidative Stress and Bone Disease Samia Abd ElMoneim Ebied , Nadia Aly Sadek, Samir Ali Abd ElKaream and Hamed Ahmed Elsawy http://www.aclr.com.es/clinical-research/an-evaluation-of-the-boditech-ichromatrade-thyroidstimulating-hormone-tsh-method-precision-and-accuracy.php?aid=24284 An Evaluation of the Boditech iCHROMA ThyroidStimulating Hormone TSH Method Precision and Accuracy Bolodeoku J, Bains S, Pinkney S, Coker O, Kim TK and Anyaeche C http://www.aclr.com.es/clinical-research/an-assessment-of-acceptance-of-results-as-generated-by-clinical-laboratories-in-mandeville-jamaica-a-perspective-of-physicians-ope.php?aid=24282 An Assessment of Acceptance of Results as Generated by Clinical Laboratories in Mandeville Jamaica A Perspective of Physicians Operating in Mandeville Fabian Pitkin http://diversityhealthcare.imedpub.com/current-issue.php Diversity & Equality in Health and Care Volume 16, Issue 2 http://diversityhealthcare.imedpub.com/comparison-between-highlytalented-and-lowtalented-nurses-on-their-characteristics-and-qualityof-nursing-care.php?aid=24345 Comparison between HighlyTalented and LowTalented Nurses on their Characteristics and Qualityof Nursing Care Hanan A Alnuqaidan and Muayyad Ahmad http://diversityhealthcare.imedpub.com/the-association-between-depression-and-diabetesand-associated-risk-factors-by-racialethnic-statusamong-adults-in-arizona-arizona-b.php?aid=24269 The Association between Depression and Diabetesand Associated Risk Factors by RacialEthnic Statusamong Adults in Arizona Arizona Behavioral RiskFactor Surveillance System 20142017 Michelle SandovalRosario, Omar A Contreras, Carla Mercado, Kamil E Barbour, Timothy J Cunningham, Cecilia B Rosales http://toxicology.imedpub.com/current-issue.php Journal of Medical Toxicology and Clinical Forensic Medicine Volume 5, Issue 1 http://toxicology.imedpub.com/generic-immunosuppression-in-transplantation-a-controversial-analysis.php?aid=24258 Generic Immunosuppression in Transplantation A Controversial Analysis Jacques Rottembourg http://toxicology.imedpub.com/hypothesize-to-designing-antidotes-to-treatment-of-aluminum-phosphide-poisoning.php?aid=24229 Hypothesize to Designing Antidotes to Treatment of Aluminum Phosphide Poisoning Majid Rezaei Basiri http://www.acanceresearch.com/current-issue.php Archives in Cancer Research Volume 7, Issue 1 http://www.acanceresearch.com/cancer-research/features-of-the-visualization-of-different-histologic-types-of-hodgkins-lymphoma-p-about-positron-emission-tomography-combined-wit.php?aid=24297 Features of the Visualization of Different Histologic Types of Hodgkins Lymphoma p about Positron Emission Tomography Combined with Computed Tomography Subbotin AS and Afanasyev NG http://www.acanceresearch.com/cancer-research/crucial-role-of-curcumin-piperine-and-taurine-on-immunological-criteria-in-hepatocellular-carcinoma-patients.php?aid=24296 Crucial Role of Curcumin Piperine and Taurine on Immunological Criteria in Hepatocellular Carcinoma Patients Abdeen SH, ElHouseini ME , Kashwaa F , ElSherbiny M , EzzAl AM , Kamel M , Abd ElHameed O and Salah A http://www.acanceresearch.com/cancer-research/evaluation-of-target-definition-for-stereotactic-reirradiation-of-recurrent-glioblastoma.php?aid=24150 Evaluation of Target Definition for Stereotactic Reirradiation of Recurrent Glioblastoma Beyzadeoglu M, Sager O, Dincoglan F and Demiral S http://www.acanceresearch.com/cancer-research/risk-factors-for-hepatocellular-carcinoma-and-its-mortality-rate-a-multicenter-study-in-indonesia.php?aid=24127 Risk Factors for Hepatocellular Carcinoma and Its Mortality Rate A Multicenter Study in Indonesia Jasirwan COM, Hasan I, Sulaiman AS, Gani RA, Lesmana CRA, Kurniawan J, Kalista KF and Nababan SH http://www.acanceresearch.com/cancer-research/persisting-dilemmas-in-etiology-and-challenges-in-screening-and-diagnosis-of-cervical-precancer-and-cancer.php?aid=24020 Persisting Dilemmas in Etiology and Challenges in Screening and Diagnosis of Cervical Precancer and Cancer Chhabra S http://www.imedpub.com/phytomedicine-and-clinical-therapeutics/current-issue.php American Journal of Phytomedicine and Clinical Therapeutics Volume 6, Issue 3 http://www.imedpub.com/articles/1acetoxychavicol-acetate-acceleratescutaneous-wound-healing-by-promotingmigration-of-epidermal-keratinocytesand-production-of-type.php?aid=24099 1rsquoAcetoxychavicol Acetate Accelerates Cutaneous Wound Healing by Promoting Migration of Epidermal Keratinocytes and Production of Type I Collagen Synthesis in Skin Fibroblasts Mori A, Sugawara K, Oboshi M, MatsuiYuasa , Tsuruta D and KojimaYuasa A http://www.imedpub.com/articles/antiinflammatory-and-sedative-effects-of-intraperitoneal-administration-of-methanolic-extract-of-emsecuridacalonge-pedunculataem-r.php?aid=23999 AntiInflammatory and Sedative Effects of IntraPeritoneal Administration of Methanolic Extract of emSecuridacalonge pedunculataem Root in Albino Rat Tijjani MB, Ngulde SI, Lewis A, Lamidi IY and Barkindo AA http://www.imedpub.com/articles/effect-of-ginger-zingiber-officinalesupplementation-on-diabetes-an-update.php?aid=23989 Effect of Ginger emZingiber officinaleemSupplementation on Diabetes An Update Araujo AJS, JesusLima JCR, Otoch JP and Pessoa AFM http://www.imedpub.com/articles/assessment-of-the-weight-reducingpotentials-of-ethanolic-seed-extract-of-colalepidota-k-schum-in-high-fat-fed-femalealbino-wistar.php?aid=23988 Assessment of the Weight ReducingPotentials of Ethanolic Seed Extract of emColalepidota Kem Schum in High Fat Fed FemaleAlbino Wistar Rats Okafor PN, Nwankpa P, Ekweogu CN, Etteh CC and Ugwueznmba PC http://www.hsprj.com/current-issue.php Health Systems and Policy Research Volume 6, Issue 1 http://www.hsprj.com/health-maintanance/behaviour-change-communicationsocial-marketing-in-hiv-aids.php?aid=24257 Behaviour Change CommunicationSocial Marketing in HIV AIDS Kiran Raj Awasthi and Mamata Sherpa Awasthi http://www.hsprj.com/health-maintanance/a-managerial-intervention-to-strengthen-the-healthy-organizational-culture-in-major-health-care-facilities-of-sri-lanka.php?aid=24038 A Managerial Intervention to Strengthen the Healthy Organizational Culture in Major Health Care Facilities of Sri Lanka LACS Dahanayake, A Jasinghe and HHDNP Opatha http://www.hsprj.com/health-maintanance/efficacy-of-free-maternity-health-policy-at-machakos-level-5-county-hospital-kenya-an-exploratory-qualitative-study.php?aid=23985 Efficacy of Free Maternity Health Policy at Machakos Level 5 County Hospital Kenya An exploratory Qualitative study Elvis Gichuhi and Adelaide Lusambili http://www.hsprj.com/health-maintanance/patientrsquos-expectations-and-satisfaction-with-nursing-care-among-admitted-patients-in-debra-tabor-general-hospital-northern-eth.php?aid=23966 Patientrsquos Expectations and Satisfaction with Nursing Care among Admitted Patients in Debra Tabor General Hospital Northern Ethiopia A Cross Sectional Study Mulu Demle Adane, Berhane Megerssa Ereso and Tilahun Fufa Debela